Information

Problem on finding sequence of Taq polymerase

Problem on finding sequence of Taq polymerase


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

As i know, Taq Polymerase can be found in Thermus aquaticus, so i do a search for protein list of Thermus aquaticus and have this : http://www.ncbi.nlm.nih.gov/genome/proteins/1724?project_id=55053 . After filter for 'polymerase' i found a lot of protein named polymerase :

  • DNA polymerase beta domain protein region
  • DNA polymerase I
  • DNA polymerase III, alpha subunit
  • DNA polymerase III, beta subunit
  • DNA polymerase III, delta subunit
  • DNA-directed DNA polymerase -…

I don't know what they mean and which is the protein i'm looking for ?


After click on one of them i have the sequence not in A-T-G-X format :

ORIGIN
1 msgvdallll gvelsraiit aysvyaivli lggflarlpt rweervealg gsfylagvil 61 wryyaggday dldlflrasg mallvlprlv rvvlreyggg r

What does it mean and how to working with it ?


According to the paper here "Taq polymerase" is the DNA polymerase I from Thermus aquaticus. (Incidentally the paper has the complete sequence of the gene in question.)

You can find a protein sequence entry at NCBI here. This shows the sequence of amino acids in the protein, not the DNA sequence of the gene. Several lines from the top you will see:

DBSOURCE locus TTHDNAP accession D32013.1

with the last word highlighted as a link. Follow that link to the DNA sequence. That entry includes the line:

CDS 1… 2499

which tells you that the initiator ATG of the gene is right at the start of the sequence shown, but that the 3026 bp sequence includes a lot of downstream DNA. If you click on CDS on that line it will highlight the coding sequence in the DNA.

A very cursory comparison of this sequence with the one in the paper that I linked to suggests that this is the same gene.


Thank Alan Boyd so much, below is the answer for these protein code mean:

A alanine P proline B aspartate/asparagine Q glutamine C cystine R arginine D aspartate S serine E glutamate T threonine F phenylalanine U selenocysteine G glycine V valine H histidine W tryptophan I isoleucine Y tyrosine K lysine Z glutamate/glutamine L leucine X any M methionine * translation stop N asparagine - gap of indeterminate length

Source from NCBI : http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml


Everything You Need to Know about Taq Polymerase

Taq polymerase is one of the most ubiquitous enzymes in molecular biology. Since its discovery in 1965 1 , Taq has become the backbone of PCR and all the downstream applications that technology enables. This powerful polymerase is the default choice for most amplification and cloning procedures, as well as diagnostic tests, marker gene DNA sequencing, and much more.

What makes Taq polymerase so special? In today’s article, we’ll take a look at the advantages and disadvantages of Taq, what you need to get the best PCR results from Taq polymerase, and some Taq derivatives that can help you achieve better results for specialised applications.


Xba I subcloning problem - (May/26/2008 )

Hi everyone!
I`ve tried to cloning a PCR product into a pBI121 vector, into XbaI-XhoI sites, and I`ve found positive clones by colony PCR. I`ve done minipreps and checked this clones whit diferents RE digestions, whit internals and externals restrictions sites, and in the all cases I`ve had beautiful bands with the correct size. excepting when I tried to digest whit XbaI again!!!
I was tried everything! I did ligation and transformation again, whit a new PCR product digested whit a new XbaI. I used TOPO, pBluescript, pUC. always I have the same result: colony PCR positives, miniprepr RE digestions positives. excepting whit Xba. the site is gone! I don`t know what can I do! I`m going to sequence this clones, but at the moment, I can`t find a logical explanation!
Can anybody help me. I`ll be very greatful!

what bacterial strain are you using? In some settings, the XbaI site will be methylated (if it is followed by TC), so this would explain why you cannot cut your plasmid with XbaI even if you could cut your (unmethylated) PCR product easily

GATC sequences in dam+ E. coli strains are methylated on the adenine. This methylation will inhibit cutting by XbaI when it overlaps the site. So, sites with sequence . gaTCTAGA. or sequence . TCTAGAtc. will fail to cut.

Hallo, this problen can by unique feature of sequence, it can tend to introduce mist mach by Taq polymerase. You can try hight fidelity polymerase like Pfu. I suggest you have designet primers with XbaI site on the 5 overhang. YOu cane use another primers with longer specer6bp behind restriction site
Good luck
Hi everyo

Hallo I have another explanation, Girl next lab has similar problem, she cloned pcr product sequenced it and found out, primers were mistmached, there was mistake in the primers. The company delivered bad primers
please replay to me results I am interested in

Baxa, I think my problem it`ll be resolve whit a strain dam-, but we`ve had problems whit bad primers too. in those cases, the company did it again, for free. If I can help you in anything, just tell me. And thanks for your answers too!

THANKS A LOT!!!! You have resolved my problem! I was using a primer whit the sequence TCTAGAtc. in a DH5-alfa E. coli strain!
THANKS!!!!


Materials and methods

Construction of recombinant plasmids

A nucleotide sequence of the Thermus aquaticus gene encoding a Stoffel fragment of the Taq DNA polymerase was obtained from the GenBank database (accession number J04639.1). The T. aquaticus strain (ATCC25104) was used to isolate a genomic DNA which was then used as a template to amplify a taq Stoffel fragment gene by using the standard PCR amplification protocol with a Hypernova DNA polymerase (BLIRT SA, Gdansk, Poland). A DNA fragment of the taq Stoffel corresponding to nucleotides 997 to 2626 was obtained in PCR using the primers: F 5’ AATTTTGTTTAACTTTAAGAAGGAGATATACATATG GCCCTGGAGGAGGCCC (forward) and R 5’ GCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTTAatggtggtggtggtggtg CTCCTTGGCGGAGAGCCAG (reverse). The primers contained sequences which were complementary to the taq Stoffel gene (underlined), a sequence complementary to pET-30 Ek/LIC vector (italics), and an oligohistidine tag sequence (lowercase). A stop codon (TTA) was added to the reverse primer immediately after the oligohistidine sequence. After amplification, the PCR product (1703 bp) was mixed with the DNA of pET-30 Ek/LIC vector (Novagen, Madison, WI, USA) which was digested by BamHI and NdeI enzymes (NEB, UK) and, following this, the mixture was used in a cloning experiment in which the OverLap Assembly kit was used (A&A Biotechnology, Poland). The E. coli TOP10 (Invitrogen, USA) cells were transformed with the help of a cloning mixture and several colonies were examined for the presence of a recombinant plasmid using a gel retardation assay and the restriction analysis.

Fusion with a NeqSSB-like gene on the N-terminal end of a taq Stoffel fragment corresponding to nucleotides 997 to 2626 was obtained in PCR with the use of the primers: F1 5’ GAGAGGCCGATGGAGGGGTCGACATGATC GCCCTGGAGGAGGCCC (forward) and R1 5’ GCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTTAatggtggtggtggtggtg CTCCTTGGCGGAGAGCCAG (reverse). The primers contained sequences complementary to the taq Stoffel gene (underlined), a sequence complementary to the pET-30 Ek/LIC vector (italics), a sequence for 6 amino acid linker residues (bolded) and a oligohistidine tag sequence (lowercase). The stop codon (TTA) was added to the reverse primer immediately following the oligohistidine sequence.

The DNA of pBAD/NeqSSB-likeHT plasmid [13] was used as a template for the amplification of the NeqSSB-like gene using the standard PCR amplification protocol. The forward primer was F2 5’ ATTTTGTTTAACTTTAAGAAGGAGATATACATATG GATGAAGAGGAACTAATACAACTAATAATAGAAAAAACT (it contained a sequence which was complementary to the NeqSSB-like gene (underlined) and a sequence which was complementary to the pET-30 Ek/LIC vector (italics)), whilst the reverse primer was R2 5’ TCCTCCAGGGCGATCATGTCGACCCCTCC ATCGGCCTCTCCTTTAAAAGCTTTTA (it contained a sequence which was complementary to the NeqSSB-like gene (underlined) and a sequence for 6 amino acid linker residues (bolded). As a result of the PCR amplification, the following two products were obtained: a taq Stoffel gene (1703 bp) and a NeqSSB-like gene (793 bp). Following this, the PCR products were mixed with the DNA of the pET-30 Ek/LIC vector (Novagen, Madison, WI, USA) which was digested by BamHI and NdeI enzymes (NEB, UK) and the resulting mixture was used in a cloning experiment in which the OverLap Assembly kit was used (A&A Biotechnology, Poland). The cloning scheme of the fusion NeqSSB-TaqS polymerase is shown in S1 Fig.

E. coli TOP10 (Invitrogen, USA) cells were transformed with the help of the cloning mixture and several colonies were examined for the presence of a recombinant plasmid using a gel retardation assay and the restriction analysis. The resulting pET30/NeqSSB-TaqS plasmid contained a complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI), a sequence of the Taq Stoffel DNA polymerase (amino acid residues from 317 to 832) and as His tag domain which enables the purification of the recombinant protein using the metal affinity chromatography.

The nucleotide sequences of the resulting recombinant plasmids, pET30/TaqS and pET30/NeqSSB-TaqS were confirmed by the DNA sequencing (Genomed, Poland).

Expression and purification of TaqS and NeqSSB-TaqS DNA polymerases

The pET30/TaqS and pET30/NeqSSB-TaqS plasmids were transformed into the E. coli BL21 (DE3) RIL (Novagen, USA). The cells with a recombinant plasmid were grown to an OD600 of 0.4 in Luria-Bertani medium at 37°C, with the addition of kanamycin and chloramphenicol at a concentration of 50 μg/ml each, and were induced by IPTG at the final concentration of 1 mM for 24 h. The cells were centrifuged at 5000xg for 12 min and the pellets were resuspended in 20 ml of buffer A (50 mM Tris-HCl pH 9, 0.5 M NaCl and 5 mM imidazole). The samples were disintegrated five times for 45 s at 4°C, and centrifuged at 10000xg for 15 min. The supernatant was heat-treated at 70°C for 15 min and the denatured host proteins were removed by centrifugation. Following this, the protein was purified in a one-step process. We used the Ni 2+ -affinity chromatographic technique. The supernatant and the enzyme which was produced were put into a His•Bind Column (Novagen, USA), which was earlier prepared and equilibrated using buffer A. The recombinant proteins were washed two times using the washing buffer B (50 mM Tris-HCl pH 9, 0.5 M NaCl and 40 mM imidazole) and then eluted with the elution buffer C (50 mM Tris-HCl pH 9, 0.5 M NaCl and 300 mM imidazole). The eluted fractions were dialyzed three times against buffer D (100 mM Tris-HCl pH 8, 100 mM KCl, 0.2 mM EDTA). The trace amounts of the genomic bacterial DNA were removed using 25 U of Benzonase (Merck, Darmstadt, Germany) and MgCl2 at the final concentration of 5 mM. Following this, the protein sample was incubated at 37°C for 1 h. The enzyme was inactivated, by incubation at 70°C for 15 min whilst the denatured proteins were removed by centrifugation. The final formulation was prepared for storage (50 mM Tris-HCl pH 8, 50 mM KCl, 1 mM DTT, 0.1 mM EDTA, 1% Tween 20, 1% Nonidet P-40 and 50% glycerol).

DNA polymerase activity assay

As directed in the EvaEZ Fluorometric Polymerase Activity Assay Kit Manual (Biotium, Hayward, USA), the DNA polymerase activity was assayed in an isothermal reaction at 72°C using MyGo/Pro Real-Time PCR instrument (IT-IS International Ltd., UK) in accordance with the definition of one unit of enzyme activity (“One unit of DNA polymerase activity is conventionally defined as the amount of enzyme that will incorporate 10 nmol of nucleotides during a 30-min incubation” [14]). The active DNA polymerase extended the primer to form a double-stranded product able to bind the EvaGreen dye with the resulting increase in fluorescence. The level of fluorescence was correlated with the polymerase activity and the number of bound nucleotides [14–16]. The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl.

Optimization of PCR amplification

We optimized the working conditions for NeqSSB-TaqS DNA polymerases. Reactions were carried out using different buffer compositions with various pH values, which included various concentrations of MgCl2, KCl and (NH4)2SO4. In all these reactions, we used 1 mM of each dNTP, 0.4 mM of each primer, and a miniprep plasmid DNA as a PCR template with a unique known target sequence and size (PCR product of 300 bp). PCR was performed using 1U of the purified NeqSSB-TaqS DNA polymerase or TaqS DNA polymerase in 20 μl of the reaction mixture containing 5 ng of a DNA template. PCR was conducted as follows: an initial denaturation at 94°C for 1 min 25 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 15 s and elongation at 72°C for 15 s. After the final cycle, the sample were incubated for 5 min at 72°C.

To determine the optimum MgCl2 concentration, the PCR was performed at increasing concentrations of MgCl2 (0–9 mM) with the use of a Tris–HCl buffer. Furthermore, the PCR was carried out using various concentrations of KCl and (NH4)2SO4 (10–90 mM) for various pH values ranging from 7.0 to 9.0 for a Tris–HCl buffer (pH values were measured at a temperature of 25°C).

Thermostability was assayed as described by Dabrowski and Kur [17]. The purified NeqSSB-TaqS and TaqS DNA polymerases were heated up to 95°C and 99°C for 1, 5, 10, 20, 40 and 60 minutes.

In all our experiments, we amplified a 300 bp target fragment in a PCR using the same amount of the enzyme in the optimal conditions. We applied 10 μl of each PCR product for visualization by agarose gel electrophoresis. The relative activity of the polymerase was evaluated by densitometry with the use of GelAnalyzer 2010a program (http://www.gelanalyzer.com/). The program measured the area below the peak representing intensity of light emitted by the band on the gel. The peak of the largest field (the highest optical density) represents a 100% polymerase activity. Peaks with smaller fields (less intensive light) were compared with the largest peak and their activity was determined as a percentage of this value.

PCR amplification rate assay

The PCR amplification rate was measured, after some modifications, using the method described by Lee et al. [11]. We used the DNA of a pET 30 plasmid containing the known target sequences as a template for the PCR in order to obtain the products with a length of 300, 500 and 1000 bp.

Amplification was performed using NeqSSB-TaqS and TaqS DNA polymerases in the optimal conditions for a PCR. Each PCR included the initial denaturation at 94°C for 2 min, and 25 cycles at 94°C for 15 s, at 55°C for 15 s and at 72°C for 5, 10, 15,…60 s. The PCR products were electrophoresed using the standard 1% agarose gel.

Processivity analysis

The processivity test was carried out as described in [18], after some modifications. Eighty five μl of 20 mM Tris-HCl pH 8.3, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 290 μM of each of the four dNTPs, 40 nM primer-template ( 5′-GGGGATCCTCTAGAGTCGACCTGC and 5’ TATCGGTCCATGAGACAAGCTTGCTTGCCAGCAGGTCGACTCTAGAGGATCCCC ), 3 μl of EvaGreen Fluorescent DNA stain (Jena Bioscience, Jena, Germany) and 1 U of the tested polymerase were pre-incubated for 5 min at 50°C. The reactions were initiated by the simultaneous addition of 7.5 μl of 50 mM MgCl2 and 7.5 μl of a 0.6 mg/μl heparin trap, and the polymerization was allowed to proceed at 72°C. Aliquots (10 μl) were withdrawn after 0, 1, 2, 5, and 10 min to cool the thermoblock (4°C) and the lengths of the extended products were determined by a melting point using a MyGo/PRO Real-time PCR instrument (IT-IS International Ltd., GB). The reaction included the following stages: a pre-melt hold for 10 s at 95°C (a ramp rate of 5°C/s), the initial 60-second stage at 60°C (a ramp rate of 4°C/s) and the final 1-second stage at 97°C (a ramp rate of 0.201°C/s). The processivity was determined by comparing the melting temperature profiles of different length products serving as markers. The marker product was obtained in a PCR using the same primer as that described above and the synthetic templates which allowed the formation of products with a length exceeding the primer’s length by 1, 2, 3 through up to 20 nt.

Primer-template binding

The binding of polymerases to the primer-template ( 5’-CTTCATTACACCTGCAGCTCT and 5’-CACAGCCCTGTCCCTCTTCTTC ) occurred at various annealing temperatures ranging from the optimal 55°C up to 72°C, with the use of primers for the PCR amplification of a human CCR5 gene [19].

Resistance to inhibitors

The effect of PCR inhibitors such as 0.84 μg to 54 μg of lactoferrin (Sigma-Aldrich, St. Louis, USA), 4.7 ng to 600 ng of heparin (Sigma-Aldrich, St. Louis, USA), and human blood (from a healthy volunteer) in concentrations ranging from 0.15% to 10%, on the catalytic activity of NeqSSB-TaqS and TaqS DNA polymerases was assessed in a PCR using the genomic DNA of Staphylococcus aureus as a template and primers for the specific nuc gene [20].

Furthermore, resistance to inhibitors present in the whole human blood was tested using primers for the amplification of human CCR5 gene [19] without the addition of any templates. PCRs were assayed as described by Kermekchiev et al. [21] with the addition of blood to the mixture (at concentrations ranging from 0.15% to 10%).

DNA binding preferences

To demonstrate the ability of DNA polymerases to bind different types of DNA (ssDNA and dsDNA) and their preferences for binding single- or double-stranded DNA, we performed the electrophoretic mobility shift assay test of the polymerase DNA complexes. The test was performed using fluorescein-labelled oligonucleotides (dT) 76 at the 5’ end, and a PCR product with a length of 100 bp, as described in the method outlined by Olszewski et al. 2015 [13]. The output products were analyzed using a 2% agarose gel ethidium bromide in the UV light.


High Fidelity DNA Polymerase: how many mutations per every kb of amplified DNA o - (Oct/17/2005 )

I talked to my co-worker the other day about new tricks in cloning and what he told me was really astonishing :

When making a transgenic mouse model, he PCRed a 2 kb fragment of DNA with High Fidelity Taq Polymerase (Roche) to use it in his cloning strategy. later, he sequenced the amplified product to find NO MUTATIons whatsoever.

I think it is a nice topic for the forum:

How far can one go with high fidelity DNA polymerase? Does anyone have any experience with the reliable amplification of 3 kb fragments? 4 kb?

I have cloned and sequenced PCR products of 3 or 4 kb many times with no errors, using high fidelity polymerase.

hi
i've sequenced a clone of 13kb and only one mutation occured.
Btw, pol are now proofreading and you can expect easily 5kb without any errors.

I've used the same polymerase for a 2,2 kb amplification. Checked 2 clones, 1 had a mutation, the other didn't. So it's a matter of luck in choosing the clones.

that's really cool! 3-4 kb and no mutations. we're talking DNA polymerase from Roche, right? It would so help me with my cloning. I 'd rather seq a bunch of clones rather than wasting time of doing the timeless RDs and gel isolations.

By "from Roche", do you mean purchased from them, or Taq-based? I used Invtrogen's HiFi polymerase (see here), but it's a mixture of Taq and another enzyme.

Any of the Hi Fi thermostable polymerases (e.g. Pfu from Pyrococcus furiosus, Vent (aka Tli) from Thermococcus litoralis, etc.) should work fine.

By "from Roche", do you mean purchased from them, or Taq-based? I used Invtrogen's HiFi polymerase (see here), but it's a mixture of Taq and another enzyme.

Any of the Hi Fi thermostable polymerases (e.g. Pfu from Pyrococcus furiosus, Vent (aka Tli) from Thermococcus litoralis, etc.) should work fine.

I mean the Expand High Fidelity PCR System, Cat # 1 732 641, that is sold by Roche Applied Science. It is composed of an enzyme mix containing thermostable Taq DNA polymerase and Tgo DNA polymerase. They mention that this system can efficiently amplify DNA fragments up tp 5 KB. On the other hand, they don't say a word of the number of possible mutations when one amplifies such a fragment.

Most hifi enzymes are indeed mixes of taq and a proofreading polymerase (such as Tgo). They have a higher fidelity than taq and are good at amplifying longer fragments.

These mixes have however a lower fidelity than pure proofreading enzymes, such as the ones homebrew mentioned. But, even with these enzymes, you can never guarantee that your clones have no mutations at all. You should always check because no polymerase whatsoever has a zero error rate.

I think the Expand High Fidelity PCR System from Roche should work fine for you. The success of your cloning (success being defined as capturing a clone with no sequence errors) is always subject to the two very true points made by vairus -- that no Taq mixture is as good as a pure high fidelity polymerase, and that there is no such thing as a polymerase that is error proof (a good thing for evolution, BTW).

So, you should sequence your clones before proceeding, to insure you're working with an unaltered copy of the DNA of interest.

I sometimes perform several separate transformations, and pick colonies from each, to assure that each clone is produced by a separate event, and that my clones are thus not siblings of one another. Luckily, I've never found a sequence error in the dozen or so times I've cloned genes >3 kb using PCR.

I have no problems with my 5-6kb products using Triple master from Eppendorf. For what I remember none of my clones to date had mutations.
Clarice


Cellular Cloning

Unicellular organisms, such as bacteria and yeast, naturally produce clones of themselves when they replicate asexually by binary fission this is known as cellular cloning. The nuclear DNA duplicates by the process of mitosis, which creates an exact replica of the genetic material.

Practice Question

Figure 1. This diagram shows the steps involved in molecular cloning.

You are working in a molecular biology lab and, unbeknownst to you, your lab partner left the foreign genomic DNA that you are planning to clone on the lab bench overnight instead of storing it in the freezer. As a result, it was degraded by nucleases, but still used in the experiment. The plasmid, on the other hand, is fine. What results would you expect from your molecular cloning experiment?

  1. There will be no colonies on the bacterial plate.
  2. There will be blue colonies only.
  3. There will be blue and white colonies.
  4. The will be white colonies only.

Mutagenesis

In order to provide the enzymes with new features that are not found in their native counterparts, they are subjected to mutations, the point changes in a range of gene sequence, encoding the given protein. Scientists use such possibilities of genome change and introduce mutations by a spontaneous or directed mutagenesis process.

In order to provide enzymes with new features not found in the native counterparts, they are subjected to mutations, point changes in a range of gene sequence, encoding the given protein. Scientists use such possibilities of genome change and introduce mutations in a spontaneous or directed mutagenesis process.

Adventitious mutagenesis consists of exposition of the given microorganism to the effect of physical or chemical mutagens, i.e., UV radiation, various types of ionizing radiation, alkylating agents, etc. Random mutations can also be introduced with PCR techniques. Amongst such methods, it is possible to distinguish the three most popular ones. First of them is DNA shuffling, which involves using DNase enzyme for cutting the DNA that encodes the given protein, which is supposed to be subjected to modification of random fragments of 50 to 100 bp, and then to carry out PCR reaction without using primers. DNA fragments obtained as a result of cutting, combined on the basis of complementarity principles and DNA polymerase, fill gaps between them. Mutations arise as a result of such a conducted reaction. After a few cycles of amplification, a modified gene occurs that is subjected again to a PCR reaction, this time with primers defining the end of the gene of the given protein, and enables one to clone it to the expressive vector (Stemmer 1994). Another technique for obtaining random mutation is the use of mutator strains. This method consists of cloning the gene, which is supposed to be subjected to mutagenesis into plasmid. Then, a transformation into modified E. coli strain is carried out, which was deprived of one or few basic repair trails of DNA (mutS, mutD, or mutT). The lack of a DNA repair system results in changes during replication in the genetic material entered into the strain as a result, the target gene undergoes random mutations. A disadvantage of this method is that the modified E. coli strain quickly loses viability, because the genes encoding basic vital functions also undergo mutations that are devoid of one of repair trails, which leads to random changes during gene replication. It is also possible to use the “error-prone PCR” technique. It consists of applying DNA polymerase with reduced replication fidelity and placing it in the reaction buffer, which is modulated in such a way that the response was non-specific. The enzyme, as a result of small catalysis specificity, introduces mutations into new stranded DNA. The control of the composition in the reaction mixture allows for adjustment of error frequencies entered into newly synthesized DNA strands. The frequency of mutation led by DNA polymerase is about 1–3 changes on 1 kbp (Hanson-Manful and Patrick 2013).

Targeted mutations primarily use PCR reactions thus, changes in the sequence can be led in a controlled way. In such techniques, modified primers are applicable, both external and internal, which have non-complementary nucleotides to the matrix, in this way introducing the desired mutation (Reikofski and Tao 1992 Ho et al. 1989).

Techniques of directed and adventitious mutagenesis have been used in the creation of polymerases with improved useful features in molecular diagnostics and genetic engineering. The most common polymerase subjected to such modifications is the best-known and most applied Taq polymerase from Thermus aquaticus. Mutations leading to changes in replication fidelity of DNA by polymerase include the highly preserved O-helix area. This is an area consisting of 12 amino acid residues from 659 to 671 amino acids, which is also a part of the space that binds the enzyme with DNA and nucleotides built to a new strand. Research shows that changes in four of 12 amino acid residues (Arg-659, Lys-663, Phe-667 and Tyr-671) lead to significant deterioration in replication fidelity by Taq DNA polymerase. Additionally, a change of 667 Phe on Tyr causes more frequent activation of ddNTP to newly-synthesized stranded DNA, which is desired in techniques of Sanger’s sequencing method (Suzuki et al. 1997, 2000). Obtaining enzymes with reduced replication fidelity is also applied in mutagenesis techniques with error-prone PCR, where such polymerases are desired.

Mutations introduced in amino acidic residues Glu-742 and Ala-743 in the subdomain of fingers of Taq DNA polymerase turn out to be very important in the affinity of the polymerase to the DNA matrix. Studies suggest that this is critical for elongation ability of the enzyme. Examined variants of mutations each time have led to an increase in the affinity of DNA and faster extending primers in comparison to a wild strain. Mutations in this range constitute a potential to obtain polymerases with improved processivity, productivities, and reaction rate (Yamagami et al. 2014).

In view of the increasing need to conduct PCR reactions, where in the reactionary mixture there are many compounds that are polymerase inhibitors, research has been conducted to find new (mutated) polymerases, which will not be sensitive to their presence. The first positive results, which resulted in the implementation of a new product, concerned modification of Taq DNA polymerase. A lot of mutants were tested and among those selected were the ones with the highest application potential. They were characterized with a much higher resistance to inhibitors included in blood with regard to wild proteins, and enabled efficient receiving amplicons at 20 % blood concentration in the reactionary mixture. Mutations were carried out in the area of zinc fingers in positions 708 and 707. Mutations in position 708 ensured resistance to the blood sample. Glutamic acid found in this position in the native polymerase was exchanged into valine, lysine, leucine, and tryptophan (Kermekchiev et al. 2009).

Changes of amino acid residues in 706, 707, and 708 may lead to formation of hot-starting polymerases. An exchange of tryptophan in position 706 to arginine, isoleucine 707 to leucine, and glutamic acid 708 to aspartic, leads to a decrease in the activity of protein at low temperatures, which increases the specificity of the PCR reaction (Kermekchiev et al. 2009).


  1. If the primers are capable of forming dimers, raising their concentration only results in the creation of primer-dimers and does not improve the amplification of the desired PCR product. Primer-derived oligomers will possibly contaminate the reaction.
  2. If the primers do not form primer-dimers, it is likely that raising the primer concentration will lead to non-specific primer binding and the creation of spurious, undesirable PCR products.

However, to amplify short PCR target sequences, careful calculation of the optimum primer concentration is required. For example, if the target fragment length is 100bp, a greater number of PCR product molecules is required to provide a specified amount of amplified DNA (in nanograms) than for a larger target fragment. In order to generate the required number of PCR product molecules, a greater number of primers may be needed. Therefore, concentration of primers higher than 1&muM may be necessary, and desirable, for short target sequences.


Yellowstone National Park – birthplace of Taq

I’ve never been to Yellowstone National Park, but it’s on my list of places I want to visit, not only for the beautiful scenery and spectacular hot springs and geysers, but also because it’s the site of origin of one of the most famous molecules in molecular biology.

Thomas Brock is a retired biologist who started his career in the early 1950s, as a microbiologist. He preferred the outdoors over the lab, so he started looking for opportunities to do more ecological studies, and in 1963 he launched a program focused on the study of microbes living in geysers and hot springs. These pools were considered to be naturally occurring steady-state ecosystems. Sort of like a controlled lab setting, but outdoors. Brock hoped that organisms the hot water pools would allow him to better understand the physiological limits of photosynthesis, but he soon made a much more interesting discovery.

Brock took samples from springs at different temperatures, and found many more microbes than he originally thought possible. Some of them even lived at temperatures higher than 73°C, which was at the time thought to be the upper limit for life. One of the sites he studied was a spring in the Lower Geyser Basin, called Mushroom Spring. In October 1966, Brock isolated culture YT-1 of a new micro organism, from a sample he had collected in Mushroom Spring at a temperature of 73°C on September 5th. He initially called his new discovery Caldobacter trichogenes, but by the time the first article about the discovery was published, the name had already changed to Thermus aquaticus.

Together with other extremophiles that Brock found in Yellowstone, culture YT-1 was dutifully recorded, and sent to the American Type Culture Collection (ATCC) where it was made available for other scientists to study.

In 1983, Kary Mullis, a scientist working at Cetus Corporation in California, had an idea to optimise the process of replicating small DNA samples in vitro. He developed a technique called PCR, or polymerase chain reaction, which uses temperature changes to unravel double stranded DNA, and small primer DNA sequences together with an enzyme called DNA polymerase to generate new strands of DNA on each half of the unraveled strand. Unravel those newly formed DNA strands, and the process starts over, each round doubling the amount of DNA.

One problem with this new technique was the the high temperatures required to unravel DNA also damaged the DNA polymerase. Other Cetus researchers set out to find a polymerase that could survive at the high temperatures needed for PCR.

All organisms have their own DNA polymerase, but our human version, for example, is optimized for our body temperature of about 37°C, and doesn’t survive extremely high temperatures. But organisms that live at high temperatures must also have polymerases that can stand the heat, and this is what they were looking for.

The researchers from Cetus analysed several of the samples that Brock had collected and deposited with ATCC, until they found what they were after in sample YT-1 of Thermus aquaticus – or Taq for short.

The technology to rapidly replicate DNA samples using PCR with Taq polymerase revolutionised modern molecular biology and is an indispensable tool in forensics. Any research involving genetics, cloning, or identifying the function of new genes will at some point have involved the use of Taq polymerase. You’ve seen the technique in action in the fictional crime labs of Law and Order, CSI, and several other shows and movies. An advertisement for a PCR machine went viral online a few years ago. Taq polymerase was the molecule of the year in 1989, and Kary Mullis won the Nobel Prize in 1993 – but PCR would not have been possible without the bacteria that Thomas Brock isolated decades earlier from a hot spring in Yellowstone.

Taq polymerase was such a success, both scientifically and commercially, that National Parks changed its regulation about research on park grounds. They haven’t seen any money from the molecule that Mullis brought to fame, and are now working with agreements that state that benefits of any “bio-prospecting” on park grounds should be shared with National Parks.

And Brock? He didn’t get any money out of his discovery either, but he didn’t mind. As quoted in TIME magazine:

“Yellowstone didn’t get any money from it. I didn’t get any money, either, and I’m not complaining. The Taq culture was provided for public research use, and it has given great benefit to mankind.”


Now for the details on how DNA Sequencing works: DNA sequencing reactions are just like the PCR reactions for replicating DNA (refer to the previous page DNA Denaturation, Annealing and Replication). The reaction mix includes the template DNA, free nucleotides, an enzyme (usually a variant of Taq polymerase) and a 'primer' - a small piece of single-stranded DNA about 20-30 nt long that can hybridize to one strand of the template DNA.

MOST of the time when a 'T' is required to make the new strand, the enzyme will get a good one and there's no problem. MOST of the time after adding a T, the enzyme will go ahead and add more nucleotides. However, 5% of the time, the enzyme will get a dideoxy-T, and that strand can never again be elongated. It eventually breaks away from the enzyme, a dead end product.

Sooner or later ALL of the copies will get terminated by a T, but each time the enzyme makes a new strand, the place it gets stopped will be random. In millions of starts, there will be strands stopping at every possible T along the way.

Gel electrophoresis can be used to separate the fragments by size and measure them. In the cartoon at left, we depict the results of a sequencing reaction run in the presence of dideoxy-Cytidine (ddC).

Well, OK, it's not so easy reading just C's, as you perhaps saw in the last figure. The spacing between the bands isn't all that easy to figure out. Imagine, though, that we ran the reaction with *all four* of the dideoxy nucleotides (A, G, C and T) present, and with *different* fluorescent colors on each. NOW look at the gel we'd get (at left). The sequence of the DNA is rather obvious if you know the color codes . just read the colors from bottom to top: TGCGTCCA-(etc).

That's exactly what we do to sequence DNA, then - we run DNA replication reactions in a test tube, but in the presence of trace amounts of all four of the dideoxy terminator nucleotides. Electrophoresis is used to separate the resulting fragments by size and we can 'read' the sequence from it, as the colors march past in order.

In a large-scale sequencing lab, we use a machine to run the electrophoresis step and to monitor the different colors as they come out. Since about 2001, these machines - not surprisingly called automated DNA sequencers - have used 'capillary electrophoresis', where the fragments are piped through a tiny glass-fiber capillary during the electrophoresis step, and they come out the far end in size-order. There's an ultraviolet laser built into the machine that shoots through the liquid emerging from the end of the capillaries, checking for pulses of fluorescent colors to emerge. There might be as many as 96 samples moving through as many capillaries ('lanes') in the most common type of sequencer.

At left is a screen shot of a real fragment of sequencing gel (this one from an older model of sequencer, but the concepts are identical). The four colors red, green, blue and yellow each represent one of the four nucleotides.

We don't even have to 'read' the sequence from the gel - the computer does that for us! Below is an example of what the sequencer's computer shows us for one sample. This is a plot of the colors detected in one 'lane' of a gel (one sample), scanned from smallest fragments to largest. The computer even interprets the colors by printing the nucleotide sequence across the top of the plot. This is just a fragment of the entire file, which would span around 900 or so nucleotides of accurate sequence.

The sequencer also gives the operator a text file containing just the nucleotide sequence, without the color traces.

As you have seen, we can get the sequence of a fragment of DNA as long as 900 or so nucleotides. Great! But what about longer pieces? The human genome is 3 *billion* bases long, arranged on 23 pairs of chromosomes. Our sequencing machine reads just a drop in the bucket compared to what we really need!

To do it, we break the entire genome up into manageable pieces and sequence them. There are two approaches currently in use:

  • The Publically-funded Human Genome Project: The National Institutes of Health and the National Science Foundation have funded the creation of 'libraries' of BAC clones. Each BAC carries a large piece of human genomic DNA on the order of 100-300 kb. All of these BACs overlap randomly, so that any one gene is probably on several different overlapping BACs. We can replicate those BACs as many times as necessary, so there's a virtually endless supply of the large human DNA fragment.

In the Publically-funded project, the BACs are subjected to shotgun sequencing (see below) to figure out their sequence. By sequencing all the BAC's, we know enough of the sequence in overlapping segments to reconstruct how the original chromosome sequence looks.

Imagine, for example that you have hundreds of 500-piece puzzles, each being assembled by a team of puzzle experts using puzzle-solving computers. Those puzzles are like BACs - smaller puzzles that make a big genome manageable. Now imagine that Celera throws all those puzzles together into one room and scrambles the pieces. They, however, have scanners that scan all the puzzle pieces and huge computers that figure out where they all go.

It is controversial still as to whether the Celera approach will succeed on a puzzle as large as the human genome. Whether it does or not, they have certainly stirred up the intellectual pot a bit.



Comments:

  1. Clodoveo

    I am final, I am sorry, it at all does not approach me. Thanks for the help.

  2. Raedan

    I'm sorry, but I think you are making a mistake. I propose to discuss it. Email me at PM, we'll talk.

  3. Zudal

    I don't understand something

  4. Hurst

    Thank you so much for your support, how can I thank you?

  5. Sat

    Entrust your move to professionals, and we will help you plan your holiday move from the very beginning! After all, a prompt and neat dacha move will save your own time and nerves.



Write a message